Transcript: Mouse NM_001033313.3

Mus musculus PDGFA associated protein 1 (Pdap1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pdap1 (231887)
Length:
2203
CDS:
111..656

Additional Resources:

NCBI RefSeq record:
NM_001033313.3
NBCI Gene record:
Pdap1 (231887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243502 TTAAACGACAACATCGTAATT pLKO_005 1301 3UTR 100% 13.200 18.480 N Pdap1 n/a
2 TRCN0000243504 GCAGTCGCTGTCCCTGAATAA pLKO_005 632 CDS 100% 13.200 10.560 N Pdap1 n/a
3 TRCN0000243503 ACGCTACATGAAGATGCATTT pLKO_005 476 CDS 100% 10.800 8.640 N Pdap1 n/a
4 TRCN0000243505 ATCTCTAGACTCAGATGAAAG pLKO_005 278 CDS 100% 10.800 7.560 N Pdap1 n/a
5 TRCN0000243501 CTGGCAATCATCCGGAAACAG pLKO_005 537 CDS 100% 4.950 3.465 N Pdap1 n/a
6 TRCN0000072373 GCTGCTATCTTTGAGACAGAA pLKO.1 845 3UTR 100% 4.950 3.465 N PDAP1 n/a
7 TRCN0000310535 GCTGCTATCTTTGAGACAGAA pLKO_005 845 3UTR 100% 4.950 3.465 N PDAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02677 pDONR223 100% 89.6% 96.6% None (many diffs) n/a
2 ccsbBroad304_02677 pLX_304 0% 89.6% 96.6% V5 (many diffs) n/a
3 TRCN0000467400 AACCTTGCGGGTGACGCCCTCTAA pLX_317 8.5% 89.6% 96.6% V5 (many diffs) n/a
Download CSV