Transcript: Mouse NM_001033445.2

Mus musculus GRB2 associated regulator of MAPK1 subtype 1 (Garem1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Garem1 (381126)
Length:
4783
CDS:
370..3000

Additional Resources:

NCBI RefSeq record:
NM_001033445.2
NBCI Gene record:
Garem1 (381126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267079 TGGAACAAGACCGGGATATAA pLKO_005 647 CDS 100% 15.000 21.000 N Garem1 n/a
2 TRCN0000267077 CCTCTCGGAGGACCAGTATTT pLKO_005 2652 CDS 100% 13.200 10.560 N Garem1 n/a
3 TRCN0000267078 CCACAACCATTTACCCAATTC pLKO_005 1461 CDS 100% 10.800 8.640 N Garem1 n/a
4 TRCN0000267081 AGTTTGACATCGATGAGTATT pLKO_005 1367 CDS 100% 13.200 9.240 N Garem1 n/a
5 TRCN0000267080 TGATTCCTAAGATACCAATAA pLKO_005 4129 3UTR 100% 13.200 9.240 N Garem1 n/a
6 TRCN0000138146 GCCTTGTACGTCACTCAACAA pLKO.1 3225 3UTR 100% 4.950 3.465 N GAREM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12483 pDONR223 100% 87.9% 91.4% None (many diffs) n/a
2 ccsbBroadEn_12484 pDONR223 100% 81.1% 84.7% None (many diffs) n/a
3 TRCN0000492035 TACGCTATCTCAAATTAAGCATGT pLX_317 14.3% 81.1% 84.7% V5 (many diffs) n/a
Download CSV