Transcript: Human NM_001034194.2

Homo sapiens exosome component 9 (EXOSC9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EXOSC9 (5393)
Length:
1638
CDS:
103..1473

Additional Resources:

NCBI RefSeq record:
NM_001034194.2
NBCI Gene record:
EXOSC9 (5393)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001034194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050882 GCAGAGTCTATAGCAAATCAA pLKO.1 955 CDS 100% 5.625 4.500 N EXOSC9 n/a
2 TRCN0000327852 GCAGAGTCTATAGCAAATCAA pLKO_005 955 CDS 100% 5.625 4.500 N EXOSC9 n/a
3 TRCN0000050881 CGTGTAGACCTACATTTATTA pLKO.1 499 CDS 100% 15.000 10.500 N EXOSC9 n/a
4 TRCN0000327926 CGTGTAGACCTACATTTATTA pLKO_005 499 CDS 100% 15.000 10.500 N EXOSC9 n/a
5 TRCN0000050878 GCTATCATTCTTGATGGTATA pLKO.1 1195 CDS 100% 10.800 7.560 N EXOSC9 n/a
6 TRCN0000327853 GCTATCATTCTTGATGGTATA pLKO_005 1195 CDS 100% 10.800 7.560 N EXOSC9 n/a
7 TRCN0000050880 GCTCCCATAATACTCTCAGAT pLKO.1 1312 CDS 100% 4.950 3.465 N EXOSC9 n/a
8 TRCN0000327854 GCTCCCATAATACTCTCAGAT pLKO_005 1312 CDS 100% 4.950 3.465 N EXOSC9 n/a
9 TRCN0000050879 GCTGGTGATTGCCATGAACAA pLKO.1 762 CDS 100% 4.950 3.465 N EXOSC9 n/a
10 TRCN0000363589 GCTGGTGATTGCCATGAACAA pLKO_005 762 CDS 100% 4.950 3.465 N EXOSC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06744 pDONR223 100% 96.1% 96% None 607A>G;1155_1205del n/a
2 ccsbBroad304_06744 pLX_304 0% 96.1% 96% V5 607A>G;1155_1205del n/a
3 TRCN0000476300 GATTGACAGTGTAAACATATTTCC pLX_317 27.3% 96.1% 96% V5 607A>G;1155_1205del n/a
Download CSV