Transcript: Human NM_001037126.1

Homo sapiens exocyst complex component 4 (EXOC4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
EXOC4 (60412)
Length:
1620
CDS:
36..1457

Additional Resources:

NCBI RefSeq record:
NM_001037126.1
NBCI Gene record:
EXOC4 (60412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160077 CCTGAACTTGTTGGATGAAAT pLKO.1 407 CDS 100% 13.200 9.240 N EXOC4 n/a
2 TRCN0000160821 CCCAGAAACAGTTAAGGCAAT pLKO.1 911 CDS 100% 4.050 2.835 N EXOC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08793 pDONR223 100% 99.7% 99.7% None 1419_1419delGinsTGAG n/a
2 ccsbBroad304_08793 pLX_304 0% 99.7% 99.7% V5 1419_1419delGinsTGAG n/a
3 TRCN0000471162 TATGGGGGAAAAATCAGCCTTACT pLX_317 35.5% 99.7% 99.7% V5 1419_1419delGinsTGAG n/a
Download CSV