Transcript: Mouse NM_001037294.1

Mus musculus alpha-kinase 2 (Alpk2), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Alpk2 (225638)
Length:
7250
CDS:
274..6708

Additional Resources:

NCBI RefSeq record:
NM_001037294.1
NBCI Gene record:
Alpk2 (225638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360869 TCCCGAGCACTCCGGAAATAT pLKO_005 5583 CDS 100% 15.000 21.000 N Alpk2 n/a
2 TRCN0000230561 GTTATGACGGATTACTCTAAT pLKO_005 1234 CDS 100% 13.200 18.480 N ALPK2 n/a
3 TRCN0000360804 GTTATGACGGATTACTCTAAT pLKO_005 1234 CDS 100% 13.200 18.480 N Alpk2 n/a
4 TRCN0000026879 CCCGTCAAAGTGTAATTCCTA pLKO.1 4913 CDS 100% 3.000 4.200 N Alpk2 n/a
5 TRCN0000026936 CCAGCGTAGAAGGAAACGAAT pLKO.1 4463 CDS 100% 4.950 3.960 N Alpk2 n/a
6 TRCN0000360870 GCGGCAAAGTGAAGATCATAA pLKO_005 3884 CDS 100% 13.200 9.240 N Alpk2 n/a
7 TRCN0000360797 TGATTCCTTCCTCGACAAATT pLKO_005 732 CDS 100% 13.200 9.240 N Alpk2 n/a
8 TRCN0000023935 CCCGAGAACAACATCCCATAT pLKO.1 6250 CDS 100% 10.800 7.560 N LOC381181 n/a
9 TRCN0000026878 CCAGGGAAGAAATTGAGTGTA pLKO.1 3722 CDS 100% 4.950 3.465 N Alpk2 n/a
10 TRCN0000023936 GACGTTGGCATAGCAACACTA pLKO.1 6460 CDS 100% 4.950 3.465 N LOC381181 n/a
11 TRCN0000026946 CCCTACAGTGAAAGAGGGTTT pLKO.1 2989 CDS 100% 4.050 2.835 N Alpk2 n/a
12 TRCN0000023938 GATTGGAGAATTCGTGAAGTA pLKO.1 6291 CDS 100% 0.000 0.000 N LOC381181 n/a
13 TRCN0000026938 CCTAAGTTTGAAAGGTCCTTA pLKO.1 5467 CDS 100% 4.950 2.970 N Alpk2 n/a
14 TRCN0000021393 CCCAAAGTACAGAAATACATT pLKO.1 1021 CDS 100% 5.625 3.938 N ALPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.