Transcript: Human NM_001037324.3

Homo sapiens endothelin converting enzyme 2 (ECE2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ECE2 (9718)
Length:
3136
CDS:
133..2343

Additional Resources:

NCBI RefSeq record:
NM_001037324.3
NBCI Gene record:
ECE2 (9718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046972 CCTCTCGGGATTACTACTTAA pLKO.1 821 CDS 100% 13.200 6.600 Y ECE2 n/a
2 TRCN0000031177 GATGCCATCTATGATATGATT pLKO.1 1522 CDS 100% 5.625 2.813 Y Ece2 n/a
3 TRCN0000046968 GCACAAGCCTTAGCAAATGAT pLKO.1 2975 3UTR 100% 5.625 2.813 Y ECE2 n/a
4 TRCN0000046969 GCTGCCTACAATGCTTACAAA pLKO.1 2059 CDS 100% 5.625 2.813 Y ECE2 n/a
5 TRCN0000046970 CCTTCCAACTAAGAATGAGAT pLKO.1 1737 CDS 100% 4.950 2.475 Y ECE2 n/a
6 TRCN0000046971 CCATCTATGATATGATTGGTT pLKO.1 1526 CDS 100% 3.000 1.500 Y ECE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07474 pDONR223 100% 99.9% 99.8% None 630C>T;959T>C n/a
2 ccsbBroad304_07474 pLX_304 0% 99.9% 99.8% V5 630C>T;959T>C n/a
3 TRCN0000475472 CCGCGACCCTACGAAGCCATTGCC pLX_317 13.3% 99.9% 99.8% V5 630C>T;959T>C n/a
Download CSV