Transcript: Mouse NM_001038607.2

Mus musculus potassium voltage-gated channel, subfamily H (eag-related), member 1 (Kcnh1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Kcnh1 (16510)
Length:
7188
CDS:
232..3120

Additional Resources:

NCBI RefSeq record:
NM_001038607.2
NBCI Gene record:
Kcnh1 (16510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068350 CGGCACTCCATACCAGTTTAA pLKO.1 1428 CDS 100% 13.200 18.480 N Kcnh1 n/a
2 TRCN0000068351 GCGGTCCAACGACACTAATTT pLKO.1 300 CDS 100% 15.000 10.500 N Kcnh1 n/a
3 TRCN0000068348 CCCTTCAGAAAGTGCTAGAAT pLKO.1 2177 CDS 100% 5.625 3.938 N Kcnh1 n/a
4 TRCN0000068349 CCCTCACATCATCCTACACTA pLKO.1 849 CDS 100% 4.950 3.465 N Kcnh1 n/a
5 TRCN0000068352 CCAGAGTCAGACAGAGACATT pLKO.1 3085 CDS 100% 4.950 2.970 N Kcnh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477687 CTACCTGCTTTGCGTCGACTGAAT pLX_317 13.8% 88.2% 96.7% V5 (many diffs) n/a
Download CSV