Transcript: Mouse NM_001038635.2

Mus musculus serine/threonine kinase 35 (Stk35), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Stk35 (67333)
Length:
5454
CDS:
25..1008

Additional Resources:

NCBI RefSeq record:
NM_001038635.2
NBCI Gene record:
Stk35 (67333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337482 CGGGAGGTGCAGCTTACATAA pLKO_005 62 CDS 100% 13.200 9.240 N Stk35 n/a
2 TRCN0000222199 GCACCAGAATATCGTGCAGTT pLKO.1 810 CDS 100% 4.050 2.835 N Stk35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13210 pDONR223 100% 29.9% 26.4% None (many diffs) n/a
2 ccsbBroad304_13210 pLX_304 0% 29.9% 26.4% V5 (many diffs) n/a
3 TRCN0000476988 CCGTTTACTGCCCTCCGTCTTCAT pLX_317 30% 29.9% 26.4% V5 (many diffs) n/a
4 TRCN0000488484 GCGGTACCCGACCAATTTCCGCGT pLX_317 28.2% 29.9% 26.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV