Transcript: Human NM_001039.4

Homo sapiens sodium channel epithelial 1 gamma subunit (SCNN1G), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SCNN1G (6340)
Length:
3477
CDS:
114..2063

Additional Resources:

NCBI RefSeq record:
NM_001039.4
NBCI Gene record:
SCNN1G (6340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044601 CCCAGCCAACAGTATTGAGAT pLKO.1 1670 CDS 100% 4.950 3.465 N SCNN1G n/a
2 TRCN0000044602 CGAGGTCTTCTTCATTGACTT pLKO.1 1763 CDS 100% 4.950 3.465 N SCNN1G n/a
3 TRCN0000044600 CGTGCCAATCAGGAACATCTA pLKO.1 1247 CDS 100% 4.950 3.465 N SCNN1G n/a
4 TRCN0000044598 GCACCTAGATAGGTTAGCATA pLKO.1 3136 3UTR 100% 4.950 3.465 N SCNN1G n/a
5 TRCN0000044599 GCCGACCATTAAAGAGCTGAT pLKO.1 179 CDS 100% 4.050 2.835 N SCNN1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01492 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01492 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479142 CGTCCACGGCTTCAGTATCCTTCA pLX_317 21.5% 100% 100% V5 n/a
Download CSV