Transcript: Mouse NM_001039059.1

Mus musculus kelch-like 15 (Klhl15), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Klhl15 (236904)
Length:
3137
CDS:
404..1117

Additional Resources:

NCBI RefSeq record:
NM_001039059.1
NBCI Gene record:
Klhl15 (236904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191927 GTTAGATGATTTCGGTGTTAA pLKO.1 820 CDS 100% 13.200 18.480 N Klhl15 n/a
2 TRCN0000200677 GCAATGTATGTTCAGCTTATA pLKO.1 725 CDS 100% 13.200 10.560 N Klhl15 n/a
3 TRCN0000192521 GCAGCAATGTATGTTCAGCTT pLKO.1 722 CDS 100% 2.640 2.112 N Klhl15 n/a
4 TRCN0000192481 CGTCTTTGAGAAGACATCGTA pLKO.1 1096 CDS 100% 0.300 0.240 N Klhl15 n/a
5 TRCN0000215471 GCTTTAGTTACCAGATCTTAT pLKO.1 1157 3UTR 100% 13.200 9.240 N Klhl15 n/a
6 TRCN0000200834 GCTCATGTCTTATTTGGATAA pLKO.1 940 CDS 100% 10.800 7.560 N Klhl15 n/a
7 TRCN0000216400 GGAACTATAGAACTAAGTATG pLKO.1 677 CDS 100% 10.800 7.560 N Klhl15 n/a
8 TRCN0000201126 CTTCGAGAAGCTCATGTCTTA pLKO.1 931 CDS 100% 4.950 3.465 N Klhl15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04205 pDONR223 100% 35.8% 38.5% None (many diffs) n/a
2 ccsbBroad304_04205 pLX_304 0% 35.8% 38.5% V5 (many diffs) n/a
3 TRCN0000468823 AGTCCTTGTGGCCTGCATTCGCGC pLX_317 27.5% 35.8% 38.5% V5 (many diffs) n/a
Download CSV