Transcript: Mouse NM_001039073.2

Mus musculus LIM domain binding 3 (Ldb3), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ldb3 (24131)
Length:
4737
CDS:
108..1976

Additional Resources:

NCBI RefSeq record:
NM_001039073.2
NBCI Gene record:
Ldb3 (24131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108691 CGGTGTTACGAGCAGTTCTTT pLKO.1 1590 CDS 100% 5.625 7.875 N Ldb3 n/a
2 TRCN0000428037 GGCAGTTATGGAGGATCTAAA pLKO_005 2337 3UTR 100% 13.200 9.240 N Ldb3 n/a
3 TRCN0000108693 CCCGATCTGTGCCAAATGTAA pLKO.1 1613 CDS 100% 5.625 3.938 N Ldb3 n/a
4 TRCN0000108694 CGGGACAGAATACATGCAAGA pLKO.1 827 CDS 100% 4.050 2.835 N Ldb3 n/a
5 TRCN0000108692 CCTCACTCTACAGAAGTCCAA pLKO.1 338 CDS 100% 2.640 1.848 N Ldb3 n/a
6 TRCN0000108690 GCTCCTGCTACTGATGACGAA pLKO.1 2011 3UTR 100% 2.640 1.848 N Ldb3 n/a
7 TRCN0000437793 GGTCAGCCATTCTACTCTAAG pLKO_005 1908 CDS 100% 10.800 6.480 N Ldb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07762 pDONR223 100% 39.9% 40% None (many diffs) n/a
2 ccsbBroad304_07762 pLX_304 0% 39.9% 40% V5 (many diffs) n/a
3 TRCN0000472162 TCCCTGTATGCGACTCTTCCCAAT pLX_317 57.1% 39.9% 40% V5 (many diffs) n/a
Download CSV