Transcript: Mouse NM_001039075.2

Mus musculus LIM domain binding 3 (Ldb3), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ldb3 (24131)
Length:
1506
CDS:
108..974

Additional Resources:

NCBI RefSeq record:
NM_001039075.2
NBCI Gene record:
Ldb3 (24131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108694 CGGGACAGAATACATGCAAGA pLKO.1 827 CDS 100% 4.050 2.835 N Ldb3 n/a
2 TRCN0000108692 CCTCACTCTACAGAAGTCCAA pLKO.1 338 CDS 100% 2.640 1.848 N Ldb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07762 pDONR223 100% 90% 95.4% None (many diffs) n/a
2 ccsbBroad304_07762 pLX_304 0% 90% 95.4% V5 (many diffs) n/a
3 TRCN0000472162 TCCCTGTATGCGACTCTTCCCAAT pLX_317 57.1% 90% 95.4% V5 (many diffs) n/a
Download CSV