Transcript: Mouse NM_001039093.1

Mus musculus target of myb1-like 2 (chicken) (Tom1l2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tom1l2 (216810)
Length:
2623
CDS:
98..1420

Additional Resources:

NCBI RefSeq record:
NM_001039093.1
NBCI Gene record:
Tom1l2 (216810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102150 GCTGGAGACTTGTGTGAAGAA pLKO.1 316 CDS 100% 4.950 3.960 N Tom1l2 n/a
2 TRCN0000065326 GTCAACGATGACCTCAACAAT pLKO.1 968 CDS 100% 5.625 3.938 N TOM1L2 n/a
3 TRCN0000102152 CAAGAATAACCCTCCCACTAT pLKO.1 412 CDS 100% 4.950 3.465 N Tom1l2 n/a
4 TRCN0000102151 CGTCAACGATGACCTCAACAA pLKO.1 967 CDS 100% 4.950 3.465 N Tom1l2 n/a
5 TRCN0000102154 CCAAGAATAACCCTCCCACTA pLKO.1 411 CDS 100% 4.050 2.835 N Tom1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04992 pDONR223 100% 66.4% 70.3% None (many diffs) n/a
2 ccsbBroad304_04992 pLX_304 0% 66.4% 70.3% V5 (many diffs) n/a
3 TRCN0000477805 TACATTACAGCGACGATCTTTAAA pLX_317 22.4% 66.4% 70.3% V5 (many diffs) n/a
Download CSV