Transcript: Human NM_001039355.3

Homo sapiens solute carrier family 25 member 29 (SLC25A29), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SLC25A29 (123096)
Length:
2291
CDS:
213..1124

Additional Resources:

NCBI RefSeq record:
NM_001039355.3
NBCI Gene record:
SLC25A29 (123096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245277 CTGAGGCCATTGCACCGTTAT pLKO_005 1395 3UTR 100% 10.800 15.120 N SLC25A29 n/a
2 TRCN0000245273 CCGTTTGACACGGTCAAGGTA pLKO_005 273 CDS 100% 3.000 4.200 N SLC25A29 n/a
3 TRCN0000044777 GCGGTACGTCAGGCATCGTGT pLKO.1 799 CDS 100% 0.000 0.000 N SLC25A29 n/a
4 TRCN0000245274 GGACGTTGCACTGCTTCAAGT pLKO_005 334 CDS 100% 4.950 3.960 N SLC25A29 n/a
5 TRCN0000044774 GCGCACCTACAAGGGCTCGCT pLKO.1 596 CDS 100% 0.000 0.000 N SLC25A29 n/a
6 TRCN0000245275 GCGTCTACTTCCTCACCTATG pLKO_005 709 CDS 100% 6.000 4.200 N SLC25A29 n/a
7 TRCN0000245276 TGTCCTGGCTCTCTACCTATC pLKO_005 817 CDS 100% 6.000 4.200 N SLC25A29 n/a
8 TRCN0000044776 CTGGCTCTCTACCTATCCTGT pLKO.1 821 CDS 100% 2.640 1.848 N SLC25A29 n/a
9 TRCN0000044775 CTCAACCAGTTCCTGGCAGGT pLKO.1 489 CDS 100% 0.720 0.504 N SLC25A29 n/a
10 TRCN0000044773 GCTGCGTGAGACGCCCAGCTT pLKO.1 686 CDS 100% 0.000 0.000 N SLC25A29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13094 pDONR223 100% 78.2% 78.2% None 1_198del n/a
2 ccsbBroad304_13094 pLX_304 0% 78.2% 78.2% V5 1_198del n/a
3 TRCN0000476991 TGTCGTGCTATGACCAACGATATA pLX_317 21.3% 78.2% 78.2% V5 1_198del n/a
Download CSV