Transcript: Mouse NM_001039364.2

Mus musculus myelin-associated oligodendrocytic basic protein (Mobp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mobp (17433)
Length:
3207
CDS:
61..306

Additional Resources:

NCBI RefSeq record:
NM_001039364.2
NBCI Gene record:
Mobp (17433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089740 TGCCTGCCAGAAGACTAGATT pLKO.1 249 CDS 100% 5.625 7.875 N Mobp n/a
2 TRCN0000089739 GCTCTCCAAGAACCAGAAGTT pLKO.1 93 CDS 100% 4.950 3.465 N Mobp n/a
3 TRCN0000089741 CCAGAAGTTCTCCGAGCACTT pLKO.1 105 CDS 100% 4.050 2.835 N Mobp n/a
4 TRCN0000089738 GCCCAAACTTTGGTAAGTTAT pLKO.1 2151 3UTR 100% 1.320 0.924 N Mobp n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2703 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01027 pDONR223 100% 87.6% 90.1% None (many diffs) n/a
2 ccsbBroad304_01027 pLX_304 0% 87.6% 90.1% V5 (many diffs) n/a
3 TRCN0000467672 CTTTGCTCACATTTCAGAGTCAAA pLX_317 100% 87.6% 90.1% V5 (many diffs) n/a
Download CSV