Transcript: Mouse NM_001039472.1

Mus musculus kinesin family member 21B (Kif21b), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Kif21b (16565)
Length:
9119
CDS:
322..5196

Additional Resources:

NCBI RefSeq record:
NM_001039472.1
NBCI Gene record:
Kif21b (16565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421745 CTGATATGGAGCGTCTCATAA pLKO_005 3137 CDS 100% 13.200 18.480 N Kif21b n/a
2 TRCN0000112890 GCCTTTAACAACCAGAGTATA pLKO.1 7778 3UTR 100% 13.200 18.480 N Kif21b n/a
3 TRCN0000112891 CCTCACTATGATGGTATTGAA pLKO.1 4831 CDS 100% 5.625 4.500 N Kif21b n/a
4 TRCN0000431345 ACAAGATAAAGGCAGATTATG pLKO_005 2435 CDS 100% 13.200 9.240 N Kif21b n/a
5 TRCN0000112892 GCAGAGAATGACCATCGTCAA pLKO.1 3108 CDS 100% 4.050 2.835 N Kif21b n/a
6 TRCN0000112893 CCACGATGACTTCAAGTTCAA pLKO.1 3711 CDS 100% 4.950 2.970 N Kif21b n/a
7 TRCN0000063896 CCCAAGCCTTTAACAACCAAA pLKO.1 7773 3UTR 100% 4.950 2.475 Y MAML3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11664 pDONR223 100% 88.7% 96% None (many diffs) n/a
2 ccsbBroad304_11664 pLX_304 0% 88.7% 96% V5 (many diffs) n/a
3 TRCN0000478126 TGCCAAGACCTCGTCTTCATATTG pLX_317 8.6% 88.7% 96% V5 (many diffs) n/a
Download CSV