Transcript: Mouse NM_001039543.2

Mus musculus myeloid leukemia factor 1 (Mlf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mlf1 (17349)
Length:
1178
CDS:
120..968

Additional Resources:

NCBI RefSeq record:
NM_001039543.2
NBCI Gene record:
Mlf1 (17349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201777 GCGCAACATGATGAGAAGTTT pLKO.1 197 CDS 100% 5.625 4.500 N Mlf1 n/a
2 TRCN0000351035 GCGCAACATGATGAGAAGTTT pLKO_005 197 CDS 100% 5.625 4.500 N Mlf1 n/a
3 TRCN0000191477 GTCAACCAAGAGTTCATCAAT pLKO.1 702 CDS 100% 5.625 4.500 N Mlf1 n/a
4 TRCN0000339650 GTCAACCAAGAGTTCATCAAT pLKO_005 702 CDS 100% 5.625 4.500 N Mlf1 n/a
5 TRCN0000190998 CAACCAAGAGTTCATCAATAT pLKO.1 704 CDS 100% 13.200 9.240 N Mlf1 n/a
6 TRCN0000339651 ACGTGATGATGGCGAAGATTC pLKO_005 287 CDS 100% 10.800 7.560 N Mlf1 n/a
7 TRCN0000351036 GAGAGTGGAAGAAGATCAAAC pLKO_005 891 CDS 100% 10.800 7.560 N Mlf1 n/a
8 TRCN0000191041 CCTGCATTTCATTTGTTTAGT pLKO.1 974 3UTR 100% 5.625 3.938 N Mlf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01018 pDONR223 100% 80.6% 76% None (many diffs) n/a
2 ccsbBroad304_01018 pLX_304 0% 80.6% 76% V5 (many diffs) n/a
3 TRCN0000468189 TCCCATAAAGTCGTAACTTTACTC pLX_317 35.1% 80.6% 76% V5 (many diffs) n/a
Download CSV