Construct: ORF TRCN0000468189
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008643.1_s317c1
- Derived from:
- ccsbBroadEn_01018
- DNA Barcode:
- TCCCATAAAGTCGTAACTTTACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MLF1 (4291)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468189
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_022443.5 | 100% | 100% | |
| 2 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001369783.1 | 94.6% | 94.6% | 196_240del |
| 3 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001130156.3 | 90.6% | 90.6% | 0_1ins75 |
| 4 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001130157.3 | 90.6% | 90.6% | 0_1ins75 |
| 5 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001369784.1 | 90.6% | 90.6% | 0_1ins75 |
| 6 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001195432.2 | 86.1% | 84.3% | (many diffs) |
| 7 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001195434.2 | 85.8% | 85.8% | 0_1ins75;121_165del |
| 8 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001369785.1 | 85.8% | 85.8% | 0_1ins75;121_165del |
| 9 | human | 4291 | MLF1 | myeloid leukemia factor 1 | XM_011512852.3 | 85.8% | 85.8% | 0_1ins75;121_165del |
| 10 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001369781.1 | 81.1% | 78.7% | (many diffs) |
| 11 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001195433.2 | 74.6% | 74.6% | 0_1ins75;204_205ins129 |
| 12 | human | 4291 | MLF1 | myeloid leukemia factor 1 | NM_001369782.1 | 72.3% | 72.3% | 0_1ins222 |
| 13 | mouse | 17349 | Mlf1 | myeloid leukemia factor 1 | NM_010801.3 | 85.1% | 80.2% | (many diffs) |
| 14 | mouse | 17349 | Mlf1 | myeloid leukemia factor 1 | NM_001039543.2 | 80.6% | 76% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 870
- ORF length:
- 804
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt caggatgctg aacagcagtt ttgaggatga ccccttcttc tctgagtcca 121 ttcttgcaca ccgagaaaat atgcgacaga tgataagaag tttttctgaa ccctttggaa 181 gagacttgct cagtatctct gatggtagag ggagagctca taatcgtaga ggacataatg 241 atggtgaaga ttctttgact catacagatg tcagctcttt ccagacaatg gaccaaatgg 301 tgtcaaatat gagaaactat atgcagaaat tagaaagaaa cttcggtcaa ctttcagtgg 361 atccaaatgg acattcattt tgttcttcct cagttatgac ttattccaaa ataggagatg 421 aaccgccaaa ggtttttcag gcctcaactc aaactcgtcg agctccagga ggaataaagg 481 aaaccaggaa agcaatgaga gattctgaca gtggactaga aaaaatggct attggtcatc 541 atatccatga ccgagctcat gtcattaaaa agtcaaagaa caagaagact GGAGATGAAG 601 AGGTCAACCA GGAGTTCATC AATATGAATG AAAGTGATGC TCATGCTTTT GATGAGGAGT 661 GGCAAAGTGA GGTTTTGAAG TACAAACCAG GACGACACAA TCTAGGAAAC ACTAGAATGA 721 GAAGTGTTGG CCATGAGAAT CCTGGCTCCC GAGAACTTAA AAGAAGGGAG AAACCTCAAC 781 AAAGTCCAGC CATTGAACAT GGAAGGAGAT CAAATGTTTT GGGGGACAAA CTCCACATCA 841 AAGGCTCATC TGTGAAAAGC AACAAAAAAT ACCCAACTTT CTTGTACAAA GTGGTTGATA 901 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 961 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATCCCA 1021 TAAAGTCGTA ACTTTACTCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1081 tgaaagatt