Transcript: Human NM_001039574.3

Homo sapiens potassium voltage-gated channel subfamily C member 4 (KCNC4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KCNC4 (3749)
Length:
4139
CDS:
1187..3067

Additional Resources:

NCBI RefSeq record:
NM_001039574.3
NBCI Gene record:
KCNC4 (3749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044941 CGTCGGAGAAGATCATCATCA pLKO.1 1287 CDS 100% 4.950 6.930 N KCNC4 n/a
2 TRCN0000044942 GACTCTAAGCAGAATGGCGAT pLKO.1 2801 CDS 100% 2.160 3.024 N KCNC4 n/a
3 TRCN0000044940 GAGACCCATGAGGCCTTTAAT pLKO.1 1922 CDS 100% 15.000 10.500 N KCNC4 n/a
4 TRCN0000420126 CACGCTGGACTTCGTCAAGAA pLKO_005 2101 CDS 100% 4.950 3.465 N KCNC4 n/a
5 TRCN0000044938 GAGGGTATGATCGAGAGGAAA pLKO.1 2774 CDS 100% 4.950 3.465 N KCNC4 n/a
6 TRCN0000069035 GTCGGAGAAGATCATCATCAA pLKO.1 1288 CDS 100% 4.950 3.465 N Kcnc4 n/a
7 TRCN0000044939 CCAATGAGTTCCTGCTGCTTA pLKO.1 2319 CDS 100% 4.950 2.970 N KCNC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488393 CCCAGCTCGCCGCAGATGCAGCCA pLX_317 18.7% 97.3% 94.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487938 CACTCCCCATTACGCCACTCGACG pLX_317 16.8% 97.2% 94.8% V5 (many diffs) n/a
3 ccsbBroadEn_10931 pDONR223 100% 88.6% 83.9% None (many diffs) n/a
4 ccsbBroad304_10931 pLX_304 0% 88.6% 83.9% V5 (many diffs) n/a
5 TRCN0000477692 ATGTGGAAGGGACAAGAACCGTAC pLX_317 23.5% 88.6% 83.9% V5 (many diffs) n/a
Download CSV