Transcript: Human NM_001039876.3

Homo sapiens spectrin repeat containing nuclear envelope family member 4 (SYNE4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SYNE4 (163183)
Length:
1377
CDS:
133..1347

Additional Resources:

NCBI RefSeq record:
NM_001039876.3
NBCI Gene record:
SYNE4 (163183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138988 CCTTATCCTCTTCCTCCTCTT pLKO.1 1203 CDS 100% 4.050 2.430 N SYNE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13333 pDONR223 100% 71.9% 71.7% None 279_617del;834G>C n/a
2 ccsbBroad304_13333 pLX_304 0% 71.9% 71.7% V5 279_617del;834G>C n/a
3 TRCN0000475268 GCTAACTTTGTGCATGCGTATAAC pLX_317 41.9% 71.9% 71.7% V5 279_617del;834G>C n/a
Download CSV