Transcript: Mouse NM_001039934.1

Mus musculus microtubule-associated protein 2 (Map2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Mus musculus (mouse)
Gene:
Map2 (17756)
Length:
5535
CDS:
448..1944

Additional Resources:

NCBI RefSeq record:
NM_001039934.1
NBCI Gene record:
Map2 (17756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089692 CCTAAGCAGCTTCGGCTTATT pLKO.1 1336 CDS 100% 1.320 1.848 N Map2 n/a
2 TRCN0000437997 GTGCCTGAAGGCTATCCAATA pLKO_005 2242 3UTR 100% 10.800 8.640 N Map2 n/a
3 TRCN0000420961 TGGATACAATCGGACAATTAT pLKO_005 2155 3UTR 100% 15.000 10.500 N Map2 n/a
4 TRCN0000416565 GATCAACTGACAACATCAAAT pLKO_005 1400 CDS 100% 13.200 9.240 N Map2 n/a
5 TRCN0000432751 ACAGGTCACAGGGCACCTATT pLKO_005 629 CDS 100% 10.800 7.560 N Map2 n/a
6 TRCN0000089688 CCTTTAGCACTGGAGTAACAT pLKO.1 1953 3UTR 100% 5.625 3.938 N Map2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06559 pDONR223 100% 79.3% 84.6% None (many diffs) n/a
2 ccsbBroad304_06559 pLX_304 0% 79.3% 84.6% V5 (many diffs) n/a
3 TRCN0000478641 CGCTTCTGCGATGCTCAGGACAGG pLX_317 23% 79.3% 84.6% V5 (many diffs) n/a
Download CSV