Transcript: Human NM_001040109.2

Homo sapiens motilin (MLN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MLN (4295)
Length:
555
CDS:
59..403

Additional Resources:

NCBI RefSeq record:
NM_001040109.2
NBCI Gene record:
MLN (4295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078007 CCTATGGCGAACTCCAGAGGA pLKO.1 150 CDS 100% 0.880 1.232 N MLN n/a
2 TRCN0000372929 GAAATTGGAATGAGGATGAAC pLKO_005 308 CDS 100% 4.950 3.465 N MLN n/a
3 TRCN0000372992 ACGAAATGATCAAGCTGACTG pLKO_005 279 CDS 100% 4.050 2.835 N MLN n/a
4 TRCN0000078004 AGGAACGGAATAAAGGGCAAA pLKO.1 180 CDS 100% 4.050 2.835 N MLN n/a
5 TRCN0000078005 CTGCTCCTCTGGAAATTGGAA pLKO.1 297 CDS 100% 3.000 2.100 N MLN n/a
6 TRCN0000372928 AGGATGAACTCCAGACAGCTG pLKO_005 320 CDS 100% 2.160 1.512 N MLN n/a
7 TRCN0000078006 CCCTGAGTGTATGGCAGAGGT pLKO.1 207 CDS 100% 0.880 0.616 N MLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06585 pDONR223 100% 98.8% 97.3% None 44T>C;336_337insGCA n/a
2 ccsbBroad304_06585 pLX_304 0% 98.8% 97.3% V5 44T>C;336_337insGCA n/a
3 TRCN0000467498 CCTCGACGATCTGCGTACGAATCA pLX_317 100% 98.8% 97.3% V5 44T>C;336_337insGCA n/a
Download CSV