Transcript: Human NM_001040446.3

Homo sapiens myotubularin related protein 12 (MTMR12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MTMR12 (54545)
Length:
5116
CDS:
102..2345

Additional Resources:

NCBI RefSeq record:
NM_001040446.3
NBCI Gene record:
MTMR12 (54545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218945 AGTGTCAACGAAGGCTATAAA pLKO_005 783 CDS 100% 15.000 21.000 N MTMR12 n/a
2 TRCN0000230374 CTAAACTGCTTAAACGATTAT pLKO_005 625 CDS 100% 13.200 18.480 N MTMR12 n/a
3 TRCN0000082644 CCGTAATGTTTGACACACTTA pLKO.1 706 CDS 100% 4.950 6.930 N MTMR12 n/a
4 TRCN0000082645 CGCTTCAAACATCAACGACAA pLKO.1 1767 CDS 100% 4.050 5.670 N MTMR12 n/a
5 TRCN0000230375 TGAATGTGCATTGACATATTT pLKO_005 4621 3UTR 100% 15.000 12.000 N MTMR12 n/a
6 TRCN0000082647 GCAAGAGAATTAGCAAACTTA pLKO.1 1876 CDS 100% 5.625 4.500 N MTMR12 n/a
7 TRCN0000082646 GCCACCCTATGAAATTGTTAA pLKO.1 1019 CDS 100% 13.200 9.240 N MTMR12 n/a
8 TRCN0000218390 TTGCCACTTACACAATCTAAG pLKO_005 1794 CDS 100% 10.800 7.560 N MTMR12 n/a
9 TRCN0000082643 GCCTTCTTAAATTAGCACTAA pLKO.1 4404 3UTR 100% 4.950 3.465 N MTMR12 n/a
10 TRCN0000230373 AGGATTGTCAGTGGCATAATT pLKO_005 588 CDS 100% 15.000 9.000 N MTMR12 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3847 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3848 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12057 pDONR223 99.7% 92.7% 92.7% None 1513_1674del n/a
2 ccsbBroad304_12057 pLX_304 0% 92.7% 92.7% V5 1513_1674del n/a
3 TRCN0000466159 CAACCTATACCTGGAGATCATGTT pLX_317 20.8% 92.7% 92.7% V5 1513_1674del n/a
Download CSV