Transcript: Human NM_001042351.3

Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
G6PD (2539)
Length:
2267
CDS:
111..1658

Additional Resources:

NCBI RefSeq record:
NM_001042351.3
NBCI Gene record:
G6PD (2539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221353 GTCGTCCTCTATGTGGAGAAT pLKO.1 1128 CDS 100% 4.950 3.960 N G6PD n/a
2 TRCN0000281207 GTCGTCCTCTATGTGGAGAAT pLKO_005 1128 CDS 100% 4.950 3.960 N G6PD n/a
3 TRCN0000221356 CCCTATATTTATGGCAGCCGA pLKO.1 1551 CDS 100% 0.660 0.528 N G6PD n/a
4 TRCN0000221355 TCAGTCGGATACACACATATT pLKO.1 191 CDS 100% 13.200 9.240 N G6PD n/a
5 TRCN0000281205 TCAGTCGGATACACACATATT pLKO_005 191 CDS 100% 13.200 9.240 N G6PD n/a
6 TRCN0000221354 CAACAGATACAAGAACGTGAA pLKO.1 1385 CDS 100% 4.050 2.835 N G6PD n/a
7 TRCN0000281204 CAACAGATACAAGAACGTGAA pLKO_005 1385 CDS 100% 4.050 2.835 N G6PD n/a
8 TRCN0000221352 GCTGATGAAGAGAGTGGGTTT pLKO.1 1592 CDS 100% 4.050 2.835 N G6PD n/a
9 TRCN0000281206 GCTGATGAAGAGAGTGGGTTT pLKO_005 1592 CDS 100% 4.050 2.835 N G6PD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06235 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06235 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467117 ATGTGTCCCAATCTGATGCATCTC pLX_317 30.1% 100% 100% V5 n/a
Download CSV