Transcript: Mouse NM_001042411.1

Mus musculus prolyl 3-hydroxylase 1 (P3h1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
P3h1 (56401)
Length:
2844
CDS:
214..1896

Additional Resources:

NCBI RefSeq record:
NM_001042411.1
NBCI Gene record:
P3h1 (56401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125115 CCTCGACTATTACCAAACCAT pLKO.1 231 CDS 100% 3.000 4.200 N P3h1 n/a
2 TRCN0000334591 CCTCGACTATTACCAAACCAT pLKO_005 231 CDS 100% 3.000 4.200 N P3h1 n/a
3 TRCN0000125116 GCACCAGAATCTGGCTTATTA pLKO.1 696 CDS 100% 15.000 12.000 N P3h1 n/a
4 TRCN0000305477 TTCCTCCCTTCACACTATAAT pLKO_005 580 CDS 100% 15.000 10.500 N P3h1 n/a
5 TRCN0000305478 AGTTTGCCTACTACAACATTG pLKO_005 608 CDS 100% 10.800 7.560 N P3h1 n/a
6 TRCN0000311322 CAGGCCATCACAGATCATTAC pLKO_005 481 CDS 100% 10.800 7.560 N P3h1 n/a
7 TRCN0000305425 CAGGGAGAATGCCGAGGAATA pLKO_005 759 CDS 100% 10.800 7.560 N P3h1 n/a
8 TRCN0000064879 CCAGGCCATCACAGATCATTA pLKO.1 480 CDS 100% 13.200 7.920 N P3H1 n/a
9 TRCN0000125114 CGGCTACAACTACCTAGACTA pLKO.1 444 CDS 100% 4.950 2.970 N P3h1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03934 pDONR223 100% 62.2% 64.5% None (many diffs) n/a
2 ccsbBroad304_03934 pLX_304 0% 62.2% 64.5% V5 (many diffs) n/a
3 TRCN0000479285 GTTATTAAATGATCAGACCCAAGT pLX_317 19.4% 62.2% 64.5% V5 (many diffs) n/a
Download CSV