Transcript: Human NM_001042450.3

Homo sapiens solute carrier family 5 member 10 (SLC5A10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A10 (125206)
Length:
3996
CDS:
42..1832

Additional Resources:

NCBI RefSeq record:
NM_001042450.3
NBCI Gene record:
SLC5A10 (125206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043638 CGTCACCTTACCTGAGTACAT pLKO.1 392 CDS 100% 4.950 6.930 N SLC5A10 n/a
2 TRCN0000043642 CTGTCTGTCTTCACCAAGATA pLKO.1 471 CDS 100% 5.625 3.938 N SLC5A10 n/a
3 TRCN0000043639 CGGGCAACTCTTCATCTACAT pLKO.1 1349 CDS 100% 4.950 3.465 N SLC5A10 n/a
4 TRCN0000043640 CATCCTCCTCATGTGTGTCAA pLKO.1 1784 CDS 100% 4.950 2.970 N SLC5A10 n/a
5 TRCN0000252451 TCCTCATGTGTGTCAACATTT pLKO_005 1789 CDS 100% 13.200 9.240 N Slc5a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489178 AGCGATGGTCATCATCGAACCAGT pLX_317 20.8% 97.3% 97.3% V5 (not translated due to prior stop codon) 979_980ins48 n/a
2 ccsbBroadEn_13112 pDONR223 100% 79% 79% None (many diffs) n/a
3 ccsbBroad304_13112 pLX_304 0% 79% 79% V5 (many diffs) n/a
Download CSV