Transcript: Human NM_001042462.2

Homo sapiens trafficking protein particle complex 5 (TRAPPC5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TRAPPC5 (126003)
Length:
5508
CDS:
59..625

Additional Resources:

NCBI RefSeq record:
NM_001042462.2
NBCI Gene record:
TRAPPC5 (126003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245666 AGGCGCGTTGCTCTTCGTCAA pLKO_005 307 CDS 100% 1.350 1.890 N TRAPPC5 n/a
2 TRCN0000245669 GTTCTCCGAGCTGGTACAGCA pLKO_005 154 CDS 100% 0.880 0.704 N TRAPPC5 n/a
3 TRCN0000245667 GCGCACCTTCTACATCATCGA pLKO_005 394 CDS 100% 2.640 1.848 N TRAPPC5 n/a
4 TRCN0000245668 GCCGCTCATCAACACCTACAT pLKO_005 421 CDS 100% 4.950 2.970 N TRAPPC5 n/a
5 TRCN0000257461 GAGAACAGCACGCTCAACTGC pLKO_005 455 CDS 100% 0.880 0.528 N TRAPPC5 n/a
6 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4569 3UTR 100% 10.800 5.400 Y MRPS16 n/a
7 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2383 3UTR 100% 4.950 2.475 Y NPHS1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2088 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4535 3UTR 100% 4.950 2.475 Y LOC387873 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2089 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4569 3UTR 100% 10.800 5.400 Y CD3EAP n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1282 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4406 3UTR 100% 4.950 2.475 Y C16orf89 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1282 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04805 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04805 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471895 AAGGTAACACGGACACAATTTAGA pLX_317 81.5% 100% 100% V5 n/a
Download CSV