Transcript: Mouse NM_001042484.1

Mus musculus golgi autoantigen, golgin subfamily a, 7 (Golga7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Golga7 (57437)
Length:
1818
CDS:
84..497

Additional Resources:

NCBI RefSeq record:
NM_001042484.1
NBCI Gene record:
Golga7 (57437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215590 GAGATACTGTAGGTGCTAATA pLKO.1 1581 3UTR 100% 13.200 18.480 N Golga7 n/a
2 TRCN0000174886 GCTTGTTCATTCCACAGATAA pLKO.1 1160 3UTR 100% 13.200 18.480 N Golga7 n/a
3 TRCN0000320043 GCTTGTTCATTCCACAGATAA pLKO_005 1160 3UTR 100% 13.200 18.480 N Golga7 n/a
4 TRCN0000174419 CAGCAGTTTGAAGAAACAGTT pLKO.1 204 CDS 100% 4.950 3.465 N Golga7 n/a
5 TRCN0000319965 CAGCAGTTTGAAGAAACAGTT pLKO_005 204 CDS 100% 4.950 3.465 N Golga7 n/a
6 TRCN0000174453 CTTTATGCAGAAGCAGAGAAA pLKO.1 240 CDS 100% 4.950 3.465 N Golga7 n/a
7 TRCN0000319967 CTTTATGCAGAAGCAGAGAAA pLKO_005 240 CDS 100% 4.950 3.465 N Golga7 n/a
8 TRCN0000174593 GAAGAAACAGTTCGAACTCTA pLKO.1 213 CDS 100% 4.950 3.465 N Golga7 n/a
9 TRCN0000320041 GAAGAAACAGTTCGAACTCTA pLKO_005 213 CDS 100% 4.950 3.465 N Golga7 n/a
10 TRCN0000193543 GTCTTGAAGAAAGTCTCCAAA pLKO.1 348 CDS 100% 4.950 3.465 N Golga7 n/a
11 TRCN0000134349 GTTTGGCTTGTTTAACAGCAT pLKO.1 289 CDS 100% 2.640 1.848 N GOLGA7 n/a
12 TRCN0000343349 GTTTGGCTTGTTTAACAGCAT pLKO_005 289 CDS 100% 2.640 1.848 N GOLGA7 n/a
13 TRCN0000339283 GAAGGTGTTCATTCAGCGAGA pLKO_005 113 CDS 100% 2.160 1.512 N Golga7 n/a
14 TRCN0000215591 GAACAGAATGAGAAGATATAT pLKO.1 378 CDS 100% 15.000 9.000 N Golga7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08225 pDONR223 100% 92.7% 98.5% None (many diffs) n/a
2 ccsbBroad304_08225 pLX_304 0% 92.7% 98.5% V5 (many diffs) n/a
3 TRCN0000468400 CTGCCTGTCACAGATCGGCATATT pLX_317 74.4% 92.7% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_03221 pDONR223 100% 88.7% 89% None (many diffs) n/a
5 ccsbBroad304_03221 pLX_304 0% 88.7% 89% V5 (many diffs) n/a
6 TRCN0000470005 GATGCGGTGTGACGGATGTTCCCA pLX_317 67.2% 88.7% 89% V5 (many diffs) n/a
Download CSV