Transcript: Mouse NM_001042513.1

Mus musculus thioredoxin reductase 1 (Txnrd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Txnrd1 (50493)
Length:
3417
CDS:
239..1738

Additional Resources:

NCBI RefSeq record:
NM_001042513.1
NBCI Gene record:
Txnrd1 (50493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042349 GCAGCCAAATTTGACAAGAAA pLKO.1 329 CDS 100% 5.625 7.875 N Txnrd1 n/a
2 TRCN0000042348 CGGGATAACAACAAATGTTAT pLKO.1 1484 CDS 100% 1.320 1.848 N Txnrd1 n/a
3 TRCN0000042352 CGGTAGGAAGAGATTCTTGTA pLKO.1 1107 CDS 100% 4.950 3.960 N Txnrd1 n/a
4 TRCN0000042350 GCAGACCAATGTGCCTTACAT pLKO.1 1204 CDS 100% 5.625 3.938 N Txnrd1 n/a
5 TRCN0000046537 CTGTATTTACTCCTTTGGAAT pLKO.1 1356 CDS 100% 4.950 3.465 N TXNRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475454 CACCAACTTGCCTTTAGTCCAAAG pLX_317 33.7% 85.5% 91.1% V5 (many diffs) n/a
2 ccsbBroadEn_07112 pDONR223 100% 85.5% 90.9% None (many diffs) n/a
3 ccsbBroad304_07112 pLX_304 0% 85.5% 90.9% V5 (many diffs) n/a
Download CSV