Transcript: Human NM_001042520.1

Homo sapiens chromosome 2 open reading frame 88 (C2orf88), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
C2orf88 (84281)
Length:
4007
CDS:
368..655

Additional Resources:

NCBI RefSeq record:
NM_001042520.1
NBCI Gene record:
C2orf88 (84281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136821 CCCTTTATGCCAGAAGAGAGA pLKO.1 446 CDS 100% 2.640 2.112 N C2orf88 n/a
2 TRCN0000135551 GAGAGTGAAGAACCCTTTATG pLKO.1 434 CDS 100% 13.200 9.240 N C2orf88 n/a
3 TRCN0000135693 CCTTTATGCCAGAAGAGAGAT pLKO.1 447 CDS 100% 4.950 3.465 N C2orf88 n/a
4 TRCN0000134456 GCTTCTCCAGTTAATGTCAAA pLKO.1 482 CDS 100% 4.950 3.465 N C2orf88 n/a
5 TRCN0000136346 GAAGAACCCTTTATGCCAGAA pLKO.1 440 CDS 100% 4.050 2.835 N C2orf88 n/a
6 TRCN0000135399 GTCAAAGAGGAAGTGAAGGAA pLKO.1 497 CDS 100% 3.000 2.100 N C2orf88 n/a
7 TRCN0000137453 GCATGAGAGTGAAGAACCCTT pLKO.1 430 CDS 100% 2.640 1.848 N C2orf88 n/a
8 TRCN0000135400 GTCTCAGGATATCTTGTGTGA pLKO.1 562 CDS 100% 2.640 1.848 N C2orf88 n/a
9 TRCN0000135401 GATATCTTGTGTGATGCCTTG pLKO.1 569 CDS 100% 2.250 1.575 N C2orf88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09174 pDONR223 100% 99.6% 98.9% None 167C>T n/a
2 ccsbBroad304_09174 pLX_304 0% 99.6% 98.9% V5 167C>T n/a
3 TRCN0000465293 CCTCGATACTTAAATCTGTCCCAA pLX_317 100% 99.6% 98.9% V5 167C>T n/a
Download CSV