Transcript: Mouse NM_001042523.1

Mus musculus thioredoxin reductase 1 (Txnrd1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Txnrd1 (50493)
Length:
3634
CDS:
114..1955

Additional Resources:

NCBI RefSeq record:
NM_001042523.1
NBCI Gene record:
Txnrd1 (50493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042349 GCAGCCAAATTTGACAAGAAA pLKO.1 546 CDS 100% 5.625 7.875 N Txnrd1 n/a
2 TRCN0000042348 CGGGATAACAACAAATGTTAT pLKO.1 1701 CDS 100% 1.320 1.848 N Txnrd1 n/a
3 TRCN0000042352 CGGTAGGAAGAGATTCTTGTA pLKO.1 1324 CDS 100% 4.950 3.960 N Txnrd1 n/a
4 TRCN0000042350 GCAGACCAATGTGCCTTACAT pLKO.1 1421 CDS 100% 5.625 3.938 N Txnrd1 n/a
5 TRCN0000046537 CTGTATTTACTCCTTTGGAAT pLKO.1 1573 CDS 100% 4.950 3.465 N TXNRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475454 CACCAACTTGCCTTTAGTCCAAAG pLX_317 33.7% 69.6% 74.2% V5 (many diffs) n/a
2 ccsbBroadEn_07112 pDONR223 100% 69.6% 74% None (many diffs) n/a
3 ccsbBroad304_07112 pLX_304 0% 69.6% 74% V5 (many diffs) n/a
Download CSV