Transcript: Human NM_001042601.3

Homo sapiens tetratricopeptide repeat domain 14 (TTC14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TTC14 (151613)
Length:
4754
CDS:
100..1419

Additional Resources:

NCBI RefSeq record:
NM_001042601.3
NBCI Gene record:
TTC14 (151613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230415 ATATTGAGCGTGGTGATATAG pLKO_005 464 CDS 100% 13.200 18.480 N TTC14 n/a
2 TRCN0000230418 CTTCATTCTATTGCGGTATAT pLKO_005 4450 3UTR 100% 13.200 18.480 N TTC14 n/a
3 TRCN0000148304 CACTTGAAATACCGGATGATT pLKO.1 3601 3UTR 100% 5.625 7.875 N TTC14 n/a
4 TRCN0000230417 TGAGCAAAGATACCGTTTAAA pLKO_005 3950 3UTR 100% 15.000 12.000 N TTC14 n/a
5 TRCN0000230416 ACCACACCTATCTGGTATTAA pLKO_005 738 CDS 100% 15.000 10.500 N TTC14 n/a
6 TRCN0000218417 AGGAGAAGTGTTGAGCTAAAT pLKO_005 799 CDS 100% 13.200 9.240 N TTC14 n/a
7 TRCN0000148200 GATGCACTAAGTAGCAAAGAA pLKO.1 4041 3UTR 100% 5.625 3.938 N TTC14 n/a
8 TRCN0000149892 GCCACCTTTAGAGCAATTCAT pLKO.1 402 CDS 100% 5.625 3.938 N TTC14 n/a
9 TRCN0000146339 CATAACAGTTGAGTGCAGAAA pLKO.1 4231 3UTR 100% 4.950 3.465 N TTC14 n/a
10 TRCN0000147294 GCAGAAATCTCTGCTTCTAAA pLKO.1 4245 3UTR 100% 1.320 0.792 N TTC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05053 pDONR223 100% 55.9% 55.8% None (many diffs) n/a
2 ccsbBroad304_05053 pLX_304 0% 55.9% 55.8% V5 (many diffs) n/a
3 TRCN0000467798 TCTAAGTAAAGCATAAAATGGTCC pLX_317 18.6% 55.9% 55.8% V5 (many diffs) n/a
Download CSV