Transcript: Mouse NM_001043336.2

Mus musculus echinoderm microtubule associated protein like 1 (Eml1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Eml1 (68519)
Length:
3806
CDS:
90..2441

Additional Resources:

NCBI RefSeq record:
NM_001043336.2
NBCI Gene record:
Eml1 (68519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001043336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090315 CCAAGTGGATTCGTACAGTTT pLKO.1 602 CDS 100% 4.950 6.930 N Eml1 n/a
2 TRCN0000090316 GCATCTACATATATGGAGTTA pLKO.1 1939 CDS 100% 4.950 6.930 N Eml1 n/a
3 TRCN0000090313 CGGATCTTTAAATAGAGGAAT pLKO.1 3515 3UTR 100% 4.950 3.960 N Eml1 n/a
4 TRCN0000090314 CCCTAGAAGGAAATTCCCTTA pLKO.1 1189 CDS 100% 4.050 2.835 N Eml1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001043336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06157 pDONR223 100% 83.1% 92.5% None (many diffs) n/a
2 ccsbBroad304_06157 pLX_304 0% 83.1% 92.5% V5 (many diffs) n/a
3 TRCN0000481317 AAGGGGCAAGAAATCACCGCTTGG pLX_317 21.7% 83.1% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_15408 pDONR223 0% 83.1% 92.2% None (many diffs) n/a
5 ccsbBroad304_15408 pLX_304 0% 83.1% 92.2% V5 (many diffs) n/a
6 TRCN0000470010 GGGCTTCAACTTGAAAGATACATT pLX_317 15% 83.1% 92.2% V5 (many diffs) n/a
Download CSV