Transcript: Mouse NM_001046637.1

Mus musculus small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Snrpa (53607)
Length:
1305
CDS:
227..1090

Additional Resources:

NCBI RefSeq record:
NM_001046637.1
NBCI Gene record:
Snrpa (53607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001046637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109125 CGTGCCAACCACACTATTTAT pLKO.1 263 CDS 100% 15.000 21.000 N Snrpa n/a
2 TRCN0000323434 CGTGCCAACCACACTATTTAT pLKO_005 263 CDS 100% 15.000 21.000 N Snrpa n/a
3 TRCN0000305276 ATGCGCATCCAGTACGCAAAG pLKO_005 488 CDS 100% 6.000 8.400 N Snrpa n/a
4 TRCN0000311266 AGCTCAAGAAGTCCCTGTATG pLKO_005 318 CDS 100% 10.800 7.560 N Snrpa n/a
5 TRCN0000109129 CAAGGCTTTAAGATCACACAA pLKO.1 1034 CDS 100% 4.950 3.465 N Snrpa n/a
6 TRCN0000109128 CTCGGACATCATTGCCAAGAT pLKO.1 514 CDS 100% 4.950 3.465 N Snrpa n/a
7 TRCN0000309176 CTCGGACATCATTGCCAAGAT pLKO_005 514 CDS 100% 4.950 3.465 N Snrpa n/a
8 TRCN0000273388 GACATCGCCTTCGTGGAGTTT pLKO_005 974 CDS 100% 4.950 3.465 N SNRPA n/a
9 TRCN0000109127 GCCAAGATGAAGGGCACCTAT pLKO.1 527 CDS 100% 4.950 3.465 N Snrpa n/a
10 TRCN0000109126 GCCTTCGTGGAGTTTGACAAT pLKO.1 980 CDS 100% 4.950 3.465 N Snrpa n/a
11 TRCN0000305277 TGGCTCAGTCCCTGAAGGTAA pLKO_005 1134 3UTR 100% 4.950 3.465 N Snrpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001046637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01566 pDONR223 100% 86.8% 94% None (many diffs) n/a
2 ccsbBroad304_01566 pLX_304 0% 86.8% 94% V5 (many diffs) n/a
3 TRCN0000472485 CATAAGTCTCGATTACTCCGGTCG pLX_317 43.9% 86.8% 94% V5 (many diffs) n/a
Download CSV