Transcript: Mouse NM_001048143.2

Mus musculus MON1 homolog B, secretory traffciking associated (Mon1b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mon1b (270096)
Length:
4857
CDS:
134..1795

Additional Resources:

NCBI RefSeq record:
NM_001048143.2
NBCI Gene record:
Mon1b (270096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001048143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250736 CTTCGGCTCATTACGATAATT pLKO_005 3003 3UTR 100% 15.000 21.000 N Mon1b n/a
2 TRCN0000250737 CTTGCTGTACACGCCCAAATT pLKO_005 722 CDS 100% 13.200 18.480 N Mon1b n/a
3 TRCN0000250734 TCGCACATAAGCAGAACTATG pLKO_005 780 CDS 100% 10.800 15.120 N Mon1b n/a
4 TRCN0000250738 CTGTTGGCGGTCGACTGATAA pLKO_005 987 CDS 100% 13.200 10.560 N Mon1b n/a
5 TRCN0000250735 ATCCGTTACCCACCCAAATAC pLKO_005 1712 CDS 100% 13.200 9.240 N Mon1b n/a
6 TRCN0000184688 CCACTGGATATCCCTGAACAA pLKO.1 1400 CDS 100% 4.950 3.465 N Mon1b n/a
7 TRCN0000179819 CGCACATAAGCAGAACTATGA pLKO.1 781 CDS 100% 4.950 3.465 N Mon1b n/a
8 TRCN0000183490 GCATGAACATATTCTGGACAT pLKO.1 2588 3UTR 100% 4.050 2.835 N Mon1b n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2243 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001048143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07810 pDONR223 100% 83.9% 87.3% None (many diffs) n/a
2 ccsbBroad304_07810 pLX_304 0% 83.9% 87.3% V5 (many diffs) n/a
3 TRCN0000479488 GGGACGCAAAGGGAGCAATGAAAT pLX_317 21.3% 83.9% 87.3% V5 (many diffs) n/a
Download CSV