Transcript: Mouse NM_001048192.2

Mus musculus ATP/GTP binding protein-like 5 (Agbl5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Agbl5 (231093)
Length:
3303
CDS:
123..2663

Additional Resources:

NCBI RefSeq record:
NM_001048192.2
NBCI Gene record:
Agbl5 (231093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001048192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031388 CAACAGGTCATGGTTCTACTT pLKO.1 332 CDS 100% 4.950 6.930 N Agbl5 n/a
2 TRCN0000031386 GCTATCCTTTGTTCACCGTTT pLKO.1 617 CDS 100% 4.050 5.670 N Agbl5 n/a
3 TRCN0000031385 GCCAATAATCTCCACAATGAA pLKO.1 1311 CDS 100% 5.625 4.500 N Agbl5 n/a
4 TRCN0000031387 CCAAAGCTCATCTCCTTGAAT pLKO.1 1593 CDS 100% 5.625 3.938 N Agbl5 n/a
5 TRCN0000031384 CCATTCCGTTTCACAGGCAAA pLKO.1 915 CDS 100% 4.050 2.835 N Agbl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001048192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12427 pDONR223 100% 75% 75.5% None (many diffs) n/a
2 ccsbBroad304_12427 pLX_304 0% 75% 75.5% V5 (many diffs) n/a
3 TRCN0000478467 TCTGTTTAATGATTCCTATCTCTC pLX_317 14.5% 75% 75.5% V5 (many diffs) n/a
Download CSV