Transcript: Human NM_001048265.2

Homo sapiens chromosome 9 open reading frame 116 (C9orf116), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C9orf116 (138162)
Length:
675
CDS:
19..429

Additional Resources:

NCBI RefSeq record:
NM_001048265.2
NBCI Gene record:
C9orf116 (138162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001048265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431775 CTCCTGTGACCGGCTCAACTT pLKO_005 366 CDS 100% 1.650 2.310 N C9orf116 n/a
2 TRCN0000428181 GGAGAGGACCAGCGACTACTA pLKO_005 81 CDS 100% 1.650 2.310 N C9orf116 n/a
3 TRCN0000414450 ATCACCCACAGTCGCCCGATT pLKO_005 494 3UTR 100% 1.350 1.890 N C9orf116 n/a
4 TRCN0000440040 AGGACCAGTAACCAGGCTTAC pLKO_005 187 CDS 100% 6.000 4.200 N C9orf116 n/a
5 TRCN0000438616 AGAAGGCTGTCTCCGTGTACA pLKO_005 167 CDS 100% 4.950 3.465 N C9orf116 n/a
6 TRCN0000179078 CCGGAACAATACTCTCAATGT pLKO.1 300 CDS 100% 4.950 3.465 N C9orf116 n/a
7 TRCN0000122113 CAATACTCTCAATGTTTACCT pLKO.1 306 CDS 100% 3.000 2.100 N C9orf116 n/a
8 TRCN0000179318 GTGGAATGTTCCGGAACAATA pLKO.1 290 CDS 100% 13.200 7.920 N C9orf116 n/a
9 TRCN0000179784 GTTACAACATCAACAGGCCAT pLKO.1 395 CDS 100% 2.160 1.296 N C9orf116 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001048265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04915 pDONR223 100% 67.6% 55.7% None 223_268del;323_408del n/a
2 ccsbBroad304_04915 pLX_304 0% 67.6% 55.7% V5 223_268del;323_408del n/a
3 TRCN0000478703 TGTCCTCGAACCGTAACATCCGTC pLX_317 100% 67.6% 55.7% V5 223_268del;323_408del n/a
Download CSV