Transcript: Human NM_001053.4

Homo sapiens somatostatin receptor 5 (SSTR5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
SSTR5 (6755)
Length:
2629
CDS:
44..1138

Additional Resources:

NCBI RefSeq record:
NM_001053.4
NBCI Gene record:
SSTR5 (6755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358170 TTCACCGTCAACATCGTCAAC pLKO_005 836 CDS 100% 4.050 5.670 N SSTR5 n/a
2 TRCN0000358172 ACCAGTTCACCAGTGTCTTCT pLKO_005 408 CDS 100% 4.950 3.960 N SSTR5 n/a
3 TRCN0000358109 CCGTCACCAACATCTACATTC pLKO_005 261 CDS 100% 10.800 7.560 N SSTR5 n/a
4 TRCN0000014400 CAACCAGTTCACCAGTGTCTT pLKO.1 406 CDS 100% 4.950 3.465 N SSTR5 n/a
5 TRCN0000014398 CGTCACCAACATCTACATTCT pLKO.1 262 CDS 100% 4.950 3.465 N SSTR5 n/a
6 TRCN0000014399 CTTCACCGTCAACATCGTCAA pLKO.1 835 CDS 100% 4.050 2.835 N SSTR5 n/a
7 TRCN0000358171 TCATCCTCTCCTACGCCAACA pLKO_005 912 CDS 100% 4.050 2.835 N SSTR5 n/a
8 TRCN0000014401 CGGCCTCTACTTCTTCGTGGT pLKO.1 892 CDS 100% 0.720 0.504 N SSTR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488541 CCATCGTCGATGGAGCCTAGGGCA pLX_317 28% 99.8% 99.7% V5 1044A>G;1092_1093insG n/a
2 TRCN0000487920 ACCCCGGGATCTATTAACCTAATA pLX_317 29.9% 99.9% 100% V5 (not translated due to prior stop codon) 1044A>G n/a
Download CSV