Transcript: Human NM_001072.4

Homo sapiens UDP glucuronosyltransferase family 1 member A6 (UGT1A6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
UGT1A6 (54578)
Length:
2455
CDS:
116..1714

Additional Resources:

NCBI RefSeq record:
NM_001072.4
NBCI Gene record:
UGT1A6 (54578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034770 CTGTAAGAAGAGGAAAGACTT pLKO.1 949 CDS 100% 4.950 3.465 N UGT1A6 n/a
2 TRCN0000034769 GAAAGACTTGTCTCAGGAATT pLKO.1 961 CDS 100% 0.000 0.000 N UGT1A6 n/a
3 TRCN0000429851 AGTGGCCTTCATCACCTTTAA pLKO_005 1615 CDS 100% 13.200 6.600 Y UGT1A6 n/a
4 TRCN0000433060 GGAATTTGAAGCCTACATTAA pLKO_005 976 CDS 100% 13.200 6.600 Y UGT1A8 n/a
5 TRCN0000365387 TGAACCATTCCCTAGTCATTT pLKO_005 1743 3UTR 100% 13.200 6.600 Y UGT1A7 n/a
6 TRCN0000370492 ACCATTCCTTGGACGTGATTG pLKO_005 1569 CDS 100% 10.800 5.400 Y UGT1A7 n/a
7 TRCN0000432861 ATGGTTGCAATTGATCCTTAA pLKO_005 2105 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
8 TRCN0000428119 GAGAAGAAAGCTATGGCAATT pLKO_005 1058 CDS 100% 10.800 5.400 Y UGT1A6 n/a
9 TRCN0000443915 GCAAAGCGCATGGAGACTAAG pLKO_005 1313 CDS 100% 10.800 5.400 Y UGT1A6 n/a
10 TRCN0000370426 GTGCTTATGGCTACCGGAAAT pLKO_005 1641 CDS 100% 10.800 5.400 Y UGT1A7 n/a
11 TRCN0000414229 GTGGGTGGGAAATAAGGTAAA pLKO_005 1718 3UTR 100% 10.800 5.400 Y UGT1A8 n/a
12 TRCN0000445577 TTGGGAGTGCGGGATTCAAAG pLKO_005 2022 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
13 TRCN0000429759 ATGACTTCTGAAGATTTAGAA pLKO_005 1364 CDS 100% 5.625 2.813 Y UGT1A6 n/a
14 TRCN0000441648 GCTGGAGTGACCCTGAATGTT pLKO_005 1337 CDS 100% 5.625 2.813 Y UGT1A6 n/a
15 TRCN0000418714 AGTTACAAGGAGAACATCATG pLKO_005 1415 CDS 100% 4.950 2.475 Y UGT1A6 n/a
16 TRCN0000036407 CACCTTTAAATGTTGTGCTTA pLKO.1 1627 CDS 100% 4.950 2.475 Y UGT1A10 n/a
17 TRCN0000034773 CATGGTGTTTATGAAAGCATA pLKO.1 1238 CDS 100% 4.950 2.475 Y UGT1A6 n/a
18 TRCN0000029531 CGAGTTAAGAAAGCCCACAAA pLKO.1 1679 CDS 100% 4.950 2.475 Y UGT1A1 n/a
19 TRCN0000436928 ATCTGCTTGGTCACCCGATGA pLKO_005 1188 CDS 100% 4.050 2.025 Y UGT1A6 n/a
20 TRCN0000034772 CCCACAAATCCAAGACCCATT pLKO.1 1692 CDS 100% 4.050 2.025 Y UGT1A6 n/a
21 TRCN0000034771 GCGAACAACACGATACTTGTT pLKO.1 1148 CDS 100% 0.495 0.248 Y UGT1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08394 pDONR223 100% 99.9% 99.8% None 962T>C n/a
2 ccsbBroad304_08394 pLX_304 0% 99.9% 99.8% V5 962T>C n/a
3 TRCN0000481568 TCCAAAGTCAAATCTCAACTGCAA pLX_317 31% 99.9% 99.8% V5 962T>C n/a
Download CSV