Transcript: Mouse NM_001077237.1

Mus musculus cDNA sequence BC003331 (BC003331), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
BC003331 (226499)
Length:
3159
CDS:
389..1636

Additional Resources:

NCBI RefSeq record:
NM_001077237.1
NBCI Gene record:
BC003331 (226499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434776 AGATGTATCACTAGGCATTAT pLKO_005 2012 3UTR 100% 13.200 18.480 N BC003331 n/a
2 TRCN0000438654 CCCAGTTGCCGTAGTTTATAG pLKO_005 2063 3UTR 100% 13.200 18.480 N BC003331 n/a
3 TRCN0000217786 CCGAGAGCTAAGTTGGATAAT pLKO.1 566 CDS 100% 13.200 18.480 N BC003331 n/a
4 TRCN0000215638 GCATGTAACAAATCACTATTA pLKO.1 1849 3UTR 100% 13.200 18.480 N BC003331 n/a
5 TRCN0000420014 GTTAGATCATGAGATTCAAAT pLKO_005 1405 CDS 100% 13.200 18.480 N BC003331 n/a
6 TRCN0000216898 GACTGTACTGTTCACGTTAAC pLKO.1 926 CDS 100% 10.800 8.640 N BC003331 n/a
7 TRCN0000197678 CACTTCACATTTGTTCTTCTA pLKO.1 798 CDS 100% 4.950 3.960 N BC003331 n/a
8 TRCN0000177681 CGAACTTACGATGTCCAAGAT pLKO.1 836 CDS 100% 4.950 3.960 N BC003331 n/a
9 TRCN0000330983 TGTGAAATGCAGAGCTTATAT pLKO_005 1141 CDS 100% 15.000 10.500 N ODR4 n/a
10 TRCN0000177803 CAGGCAGTGAAGAGAGATATT pLKO.1 1196 CDS 100% 13.200 9.240 N BC003331 n/a
11 TRCN0000216875 GATGTATCACTAGGCATTATC pLKO.1 2013 3UTR 100% 13.200 9.240 N BC003331 n/a
12 TRCN0000215470 GTAATGTTATGTGACTATAAG pLKO.1 1337 CDS 100% 13.200 9.240 N BC003331 n/a
13 TRCN0000443351 CAAGCAGCTCTGCTACGTTAA pLKO_005 1716 3UTR 100% 10.800 7.560 N BC003331 n/a
14 TRCN0000176753 CTTTAGAACTAGCAGATGATT pLKO.1 678 CDS 100% 5.625 3.938 N BC003331 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12120 pDONR223 100% 63.9% 63.2% None (many diffs) n/a
2 ccsbBroad304_12120 pLX_304 0% 63.9% 63.2% V5 (many diffs) n/a
3 TRCN0000467046 ACCTGGACCTAACAACAGGTACAA pLX_317 30.9% 63.9% 63.2% V5 (many diffs) n/a
Download CSV