Transcript: Human NM_001077350.3

Homo sapiens NPR3 like, GATOR1 complex subunit (NPRL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NPRL3 (8131)
Length:
3128
CDS:
100..1809

Additional Resources:

NCBI RefSeq record:
NM_001077350.3
NBCI Gene record:
NPRL3 (8131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135904 GCAACCAAGTCTGAAATGTGT pLKO.1 319 CDS 100% 3.000 4.200 N NPRL3 n/a
2 TRCN0000133940 CAGTGATAAACTGTCTGCATA pLKO.1 509 CDS 100% 4.950 3.465 N NPRL3 n/a
3 TRCN0000135594 GTGTGAGAACAACGTCTACAT pLKO.1 1083 CDS 100% 4.950 3.465 N NPRL3 n/a
4 TRCN0000136458 CCTGAAGAATGTGCAGAAACA pLKO.1 2198 3UTR 100% 4.950 2.970 N NPRL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01866 pDONR223 100% 68.5% 68.5% None 1_537del n/a
2 ccsbBroad304_01866 pLX_304 0% 68.5% 68.5% V5 1_537del n/a
3 TRCN0000465315 ATCCGACCTACTTATATGGAAAGC pLX_317 32.3% 68.5% 68.5% V5 1_537del n/a
Download CSV