Transcript: Human NM_001077394.1

Homo sapiens diphthamide biosynthesis 5 (DPH5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
DPH5 (51611)
Length:
1828
CDS:
166..1023

Additional Resources:

NCBI RefSeq record:
NM_001077394.1
NBCI Gene record:
DPH5 (51611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158161 CTCAGTCCTAACTGTAGGGAA pLKO.1 270 CDS 100% 2.640 3.696 N DPH5 n/a
2 TRCN0000292280 AGGTGTTGTGGTAGGTAATTG pLKO_005 1134 3UTR 100% 13.200 9.240 N DPH5 n/a
3 TRCN0000153096 GCTGCTGTGGTTTACAGTTAT pLKO.1 518 CDS 100% 13.200 9.240 N DPH5 n/a
4 TRCN0000292279 GCTGCTGTGGTTTACAGTTAT pLKO_005 518 CDS 100% 13.200 9.240 N DPH5 n/a
5 TRCN0000157918 CCTTGTGGTTGGTGATCCATT pLKO.1 402 CDS 100% 4.950 3.465 N DPH5 n/a
6 TRCN0000152528 GATGGAGATGCTAAGTCTGTT pLKO.1 954 CDS 100% 4.950 3.465 N DPH5 n/a
7 TRCN0000153031 GAGACACTTTGTGTTGGCTTA pLKO.1 811 CDS 100% 4.050 2.835 N DPH5 n/a
8 TRCN0000292278 GAGACACTTTGTGTTGGCTTA pLKO_005 811 CDS 100% 4.050 2.835 N DPH5 n/a
9 TRCN0000157585 GCATTCCTTGTGGTTGGTGAT pLKO.1 397 CDS 100% 4.050 2.835 N DPH5 n/a
10 TRCN0000292221 GCATTCCTTGTGGTTGGTGAT pLKO_005 397 CDS 100% 4.050 2.835 N DPH5 n/a
11 TRCN0000152500 GCTGATAGAGAAGAAGTGGAA pLKO.1 331 CDS 100% 2.640 1.848 N DPH5 n/a
12 TRCN0000292220 GCTGATAGAGAAGAAGTGGAA pLKO_005 331 CDS 100% 2.640 1.848 N DPH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12001 pDONR223 100% 16.1% 16.1% None 1_717del n/a
2 ccsbBroad304_12001 pLX_304 0% 16.1% 16.1% V5 1_717del n/a
3 TRCN0000468835 GGCCAGACATCGATCTACGTGTAA pLX_317 100% 16.1% 16.1% V5 1_717del n/a
Download CSV