Transcript: Human NM_001078.4

Homo sapiens vascular cell adhesion molecule 1 (VCAM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
VCAM1 (7412)
Length:
3101
CDS:
120..2339

Additional Resources:

NCBI RefSeq record:
NM_001078.4
NBCI Gene record:
VCAM1 (7412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001078.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414856 GAATGCAACTCTCACCTTAAT pLKO_005 1799 CDS 100% 13.200 18.480 N VCAM1 n/a
2 TRCN0000412974 GGAATTAATTATCCAAGTTAC pLKO_005 1895 CDS 100% 10.800 8.640 N VCAM1 n/a
3 TRCN0000123171 CGAGCTAAATTACACATTGAT pLKO.1 705 CDS 100% 5.625 3.938 N VCAM1 n/a
4 TRCN0000123172 CCAGATAGATAGTCCACTGAA pLKO.1 302 CDS 100% 4.950 3.465 N VCAM1 n/a
5 TRCN0000123170 CGGGAGTATATGAATGTGAAT pLKO.1 2107 CDS 100% 4.950 3.465 N VCAM1 n/a
6 TRCN0000123173 CTGGAGATAGACTTACTGAAA pLKO.1 561 CDS 100% 4.950 3.465 N VCAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001078.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01763 pDONR223 100% 99.9% 100% None 2208G>A n/a
2 ccsbBroad304_01763 pLX_304 0% 99.9% 100% V5 2208G>A n/a
3 TRCN0000473670 CCAGACTCTCATTCTTATGATCGA pLX_317 16.1% 99.9% 100% V5 2208G>A n/a
Download CSV