Transcript: Human NM_001079512.4

Homo sapiens trans-golgi network vesicle protein 23 homolog A (TVP23A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TVP23A (780776)
Length:
3370
CDS:
302..943

Additional Resources:

NCBI RefSeq record:
NM_001079512.4
NBCI Gene record:
TVP23A (780776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268245 TTCGATGGTGGAACCAGATAG pLKO_005 564 CDS 100% 10.800 15.120 N Tvp23a n/a
2 TRCN0000269932 TTCGATGGTGGAACCAGATAG pLKO_005 564 CDS 100% 10.800 15.120 N TVP23A n/a
3 TRCN0000269787 CCTACCTAGCACTCATCATTT pLKO_005 2972 3UTR 100% 13.200 9.240 N TVP23A n/a
4 TRCN0000284094 CTTCTGGCTGGGCCTCATAAT pLKO_005 670 CDS 100% 13.200 9.240 N TVP23A n/a
5 TRCN0000269854 CAGGAAGGTCTCTCCGAATAG pLKO_005 619 CDS 100% 10.800 7.560 N TVP23A n/a
6 TRCN0000269877 GGAAGAGCCACTGGATCTTTG pLKO_005 594 CDS 100% 10.800 7.560 N TVP23A n/a
7 TRCN0000047584 CGATGGTGGAACCAGATAGAT pLKO.1 566 CDS 100% 5.625 3.938 N LOC283816 n/a
8 TRCN0000047583 CCCATGATATGGATTGTGTTT pLKO.1 695 CDS 100% 4.950 3.465 N LOC283816 n/a
9 TRCN0000047587 GCTGGCCTTTAGGAAAGCCAA pLKO.1 364 CDS 100% 2.640 1.848 N LOC283816 n/a
10 TRCN0000047586 CTGTGAAGAATGTAACCGGAA pLKO.1 528 CDS 100% 2.160 1.512 N LOC283816 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05741 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05741 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480830 TATACTAGCCTCATTATCCTGTAT pLX_317 58.6% 100% 100% V5 n/a
Download CSV