Transcript: Human NM_001080439.3

Homo sapiens heat shock transcription factor 5 (HSF5), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
HSF5 (124535)
Length:
4118
CDS:
135..1925

Additional Resources:

NCBI RefSeq record:
NM_001080439.3
NBCI Gene record:
HSF5 (124535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016962 CACTGCAACTACTTCCAGAAT pLKO.1 1137 CDS 100% 4.950 6.930 N HSF5 n/a
2 TRCN0000016960 CCTAGTGAAGACACAGGTTTA pLKO.1 1776 CDS 100% 10.800 7.560 N HSF5 n/a
3 TRCN0000016961 CCACAGTACTTACCCTCTGAA pLKO.1 770 CDS 100% 4.950 3.465 N HSF5 n/a
4 TRCN0000016959 CGCTTTCCAAAGGAGGAAGAA pLKO.1 1893 CDS 100% 4.950 3.465 N HSF5 n/a
5 TRCN0000016958 GCTGTCTTTCAGATAGTTGAT pLKO.1 1254 CDS 100% 4.950 3.465 N HSF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13106 pDONR223 100% 79.6% 79.6% None 157_519del n/a
2 ccsbBroad304_13106 pLX_304 0% 79.6% 79.6% V5 157_519del n/a
3 TRCN0000469247 ACCTCAGAATGCCGACACAAGTCC pLX_317 31.9% 79.6% 79.6% V5 157_519del n/a
Download CSV