Transcript: Mouse NM_001081074.1

Mus musculus APOBEC1 complementation factor (A1cf), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
A1cf (69865)
Length:
3828
CDS:
145..1932

Additional Resources:

NCBI RefSeq record:
NM_001081074.1
NBCI Gene record:
A1cf (69865)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252988 CAAGATTTATTCGTCGTATTA pLKO_005 2055 3UTR 100% 13.200 18.480 N A1cf n/a
2 TRCN0000252987 GTCGAGGATACCACGTCAAAG pLKO_005 1367 CDS 100% 10.800 15.120 N A1cf n/a
3 TRCN0000061846 GAATGCAATCAAGCAACTTAA pLKO.1 474 CDS 100% 13.200 10.560 N A1CF n/a
4 TRCN0000286827 GAATGCAATCAAGCAACTTAA pLKO_005 474 CDS 100% 13.200 10.560 N A1CF n/a
5 TRCN0000267468 ACAAGACTTAGCAGCATATAC pLKO_005 1848 CDS 100% 13.200 9.240 N A1cf n/a
6 TRCN0000294280 ACAAGACTTAGCAGCATATAC pLKO_005 1848 CDS 100% 13.200 9.240 N A1CF n/a
7 TRCN0000252989 CTGTACGTAAGGAACCTTATG pLKO_005 841 CDS 100% 10.800 7.560 N A1cf n/a
8 TRCN0000252990 TGCCATTGGACAAGATCAAAG pLKO_005 1551 CDS 100% 10.800 7.560 N A1cf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11916 pDONR223 100% 18.8% 19.8% None (many diffs) n/a
2 ccsbBroad304_11916 pLX_304 0% 18.8% 19.8% V5 (many diffs) n/a
3 TRCN0000466634 TTTAGGCCAATCCAAGCGCCTCCC pLX_317 98.4% 18.8% 19.8% V5 (many diffs) n/a
Download CSV