Transcript: Mouse NM_001081103.2

Mus musculus stromal interaction molecule 2 (Stim2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Stim2 (116873)
Length:
4930
CDS:
362..2602

Additional Resources:

NCBI RefSeq record:
NM_001081103.2
NBCI Gene record:
Stim2 (116873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187841 GACGAAGTAGACCACAAGATT pLKO.1 1580 CDS 100% 5.625 7.875 N Stim2 n/a
2 TRCN0000203864 CCTCTGTCATAATGGTGAGAA pLKO.1 2530 CDS 100% 4.950 3.465 N Stim2 n/a
3 TRCN0000187941 GCTTCAGAATGTGACTCCTTA pLKO.1 2141 CDS 100% 4.950 3.465 N Stim2 n/a
4 TRCN0000204753 GCTTGGAAGCACTTCAGACAA pLKO.1 564 CDS 100% 4.950 3.465 N Stim2 n/a
5 TRCN0000204366 CCACCTTGCTTCACTGAAGAA pLKO.1 533 CDS 100% 4.950 2.970 N Stim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08749 pDONR223 100% 61.6% 66.8% None (many diffs) n/a
2 ccsbBroad304_08749 pLX_304 0% 61.6% 66.8% V5 (many diffs) n/a
3 TRCN0000477969 CAAAGACCCGGTAGCAACATAGAT pLX_317 20.4% 61.6% 66.8% V5 (many diffs) n/a
Download CSV