Transcript: Mouse NM_001081208.2

Mus musculus heparan sulfate (glucosamine) 3-O-sulfotransferase 5 (Hs3st5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hs3st5 (319415)
Length:
2958
CDS:
1008..2048

Additional Resources:

NCBI RefSeq record:
NM_001081208.2
NBCI Gene record:
Hs3st5 (319415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254659 AGGATAAGTCAGTACAATTTA pLKO_005 1839 CDS 100% 15.000 21.000 N Hs3st5 n/a
2 TRCN0000254658 CATTACCAAATTGCGCAAATT pLKO_005 1967 CDS 100% 13.200 18.480 N Hs3st5 n/a
3 TRCN0000254661 GTTGCATCTGTTAAGCTATTT pLKO_005 2253 3UTR 100% 13.200 10.560 N Hs3st5 n/a
4 TRCN0000254660 TGTGAAGTGAACACGAAATAC pLKO_005 1665 CDS 100% 13.200 9.240 N Hs3st5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09880 pDONR223 100% 90% 96.8% None (many diffs) n/a
2 ccsbBroad304_09880 pLX_304 0% 90% 96.8% V5 (many diffs) n/a
3 TRCN0000475882 CGCACCCCTGTGATTACCAATCCT pLX_317 37.6% 90% 96.8% V5 (many diffs) n/a
Download CSV