Transcript: Mouse NM_001081231.2

Mus musculus lipoma HMGIC fusion partner-like 3 (Lhfpl3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lhfpl3 (269629)
Length:
2981
CDS:
1..687

Additional Resources:

NCBI RefSeq record:
NM_001081231.2
NBCI Gene record:
Lhfpl3 (269629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265568 CATAAGACCGTGCTCATATTT pLKO_005 2257 3UTR 100% 15.000 21.000 N Lhfpl3 n/a
2 TRCN0000254578 CTGGGATTCAGACGAAGTAAA pLKO_005 474 CDS 100% 13.200 9.240 N Lhfpl3 n/a
3 TRCN0000254580 TTGTCCTTGGCTGTATGATTT pLKO_005 443 CDS 100% 13.200 9.240 N Lhfpl3 n/a
4 TRCN0000265591 TCTGCTTTGCCATCGTCAATG pLKO_005 122 CDS 100% 10.800 7.560 N Lhfpl3 n/a
5 TRCN0000140067 CAAGCTGTACCACACCAACTA pLKO.1 54 CDS 100% 4.950 3.465 N LHFPL3 n/a
6 TRCN0000140567 GCTGTACCACACCAACTATGT pLKO.1 57 CDS 100% 4.950 3.465 N LHFPL3 n/a
7 TRCN0000254579 TGGCTATCATCGGAATCTTAG pLKO_005 563 CDS 100% 10.800 6.480 N Lhfpl3 n/a
8 TRCN0000140585 GCCATCTTCACCATCTGCTTT pLKO.1 109 CDS 100% 4.950 2.475 Y LHFPL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16163 pDONR223 0% 94.2% 97.8% None (many diffs) n/a
2 ccsbBroad304_16163 pLX_304 0% 94.2% 97.8% V5 (many diffs) n/a
3 ccsbBroadEn_10073 pDONR223 100% 90.3% 93.6% None (many diffs) n/a
4 ccsbBroad304_10073 pLX_304 0% 90.3% 93.6% V5 (many diffs) n/a
5 TRCN0000474367 AAGACGCACGGGCGAAAAAAGAGC pLX_317 53.6% 90.3% 93.6% V5 (many diffs) n/a
Download CSV