Transcript: Mouse NM_001081308.2

Mus musculus TAO kinase 3 (Taok3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Taok3 (330177)
Length:
4258
CDS:
280..2976

Additional Resources:

NCBI RefSeq record:
NM_001081308.2
NBCI Gene record:
Taok3 (330177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148231 AACAGATGTCAGGTTATAAG pXPR_003 CGG 1392 52% 14 0.514 Taok3 TAOK3 76737
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242196 AGCGCTTTGCCACGATCAAAT pLKO_005 1577 CDS 100% 13.200 18.480 N Taok3 n/a
2 TRCN0000273361 AGCGCTTTGCCACGATCAAAT pLKO_005 1577 CDS 100% 13.200 18.480 N TAOK3 n/a
3 TRCN0000242195 CTTCAGGAGATTCGTTGATTA pLKO_005 1026 CDS 100% 13.200 18.480 N Taok3 n/a
4 TRCN0000273334 GGAACAGATGTCAGGTTATAA pLKO_005 1653 CDS 100% 15.000 10.500 N TAOK3 n/a
5 TRCN0000242197 CAACGAGGTGGTCGCTGTTAA pLKO_005 417 CDS 100% 13.200 9.240 N Taok3 n/a
6 TRCN0000242194 GAGCGGATATCGAAGCATAAA pLKO_005 2017 CDS 100% 13.200 9.240 N Taok3 n/a
7 TRCN0000242193 GCCGTGTACTTTGCGACAAAT pLKO_005 388 CDS 100% 13.200 9.240 N Taok3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15065 pDONR223 0% 88.5% 95.5% None (many diffs) n/a
2 ccsbBroad304_15065 pLX_304 0% 88.5% 95.5% V5 (many diffs) n/a
3 TRCN0000465631 GATCACGGGGCAACCCTTCGATAC pLX_317 13.2% 88.5% 95.5% V5 (many diffs) n/a
4 TRCN0000487785 CCTCCAGGGTGACACTCCAAACGT pLX_317 10.6% 88.5% 95.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488252 CCATAATCCTTCGCATTACGCTCA pLX_317 13.1% 88.5% 95.4% V5 (many diffs) n/a
Download CSV